J. Biol. Chem., Vol. 282, Issue 1, 200-207

Co-immunoprecipitation of Endogenous Galectin-3 and MUC1 in HT29 Human Colon Cancer Cells—MUC1 immunoprecipitation of HT29 cell lysates using B27.29 anti-MUC1 antibody followed by immunoblotting with anti-galectin-3 antibody shows the presence of endogenous galectin-3 in MUC1 immunoprecipitates but not in the control Bcl-2 immunoprecipitates (Fig. 1A). In the reciprocal experiment, galectin-3 immunoprecipitation followed by MUC1 immunoblotting also shows the presence of MUC1 in galectin-3 immunoprecipitates but not in the control immunoglobulin immunoprecipitates (Fig. 1B). These results suggest a probable interaction between galectin-3 and MUC1 in colon cancer cells.

J. Biol. Chem., Vol. 282, Issue 1, 200-207

This study not only implies a critical role for circulating galectin-3 in cancer metastasis but also highlights the functional importance of altered cell surface glycosylation in the development and progression of cancer. 结论分析：用了两个非常好的动词！implies，highlights；两个非常好的形容词critical，importance

J. Clin. Invest. 118(1): 29-39 (2007)

The GPCR modulator protein RAMP2 is essential for angiogenesis and vascular integrity

J. Clin. Invest. 118(1): 29-39 (2007)

The GPCR modulator protein RAMP2 is essential for angiogenesis and vascular integrityJ. Clin. Invest. Yuka Ichikawa-Shindo, et al. 118:29 doi:10.1172/JCI33022 [Go to this article.] Figure 2Quantitative real-time PCR analysis, macroscopic analysis, and histology of RAMP2–/– embryos. (A) Gene expression of AM, CRLR, and RAMPs in E13.5 WT and RAMP2–/– embryos, assessed by real-time PCR of total RNA. No RAMP2 expression was detected in RAMP2–/– mice, confirming RAMP2 was successfully destroyed. Conversely, RAMP3 expression did not differ between RAMP2–/– and WT mice, showing that the absence of RAMP2 did not induce compensatory upregulation of RAMP3 during development. AM expression was upregulated more than 5-fold in RAMP2–/– mice. n = 6 per group. **P < 0.01 vs. WT. (B–L) Development of blood vessels in E13.5 WT and RAMP2–/– mice. Appearance of the yolk sac (B) and vitelline arteries (C and D). (E and F) CD31 immunostaining of sections of yolk sacs. Arrows indicate sections of vitelline arteries. (G and H) Whole-mount immunofluorescence staining of CD31 in yolk sacs. In C–H, vitelline arteries were well developed on the yolk sacs of WT mice but poorly developed on those of RAMP2–/– mice. (I–L) TUNEL staining of sections of vitelline artery (I and J) and umbilical vessel (K and L) in E13.5 WT and RAMP2–/– embryos. Apoptosis was visualized in green fluorescence. Arrows indicate vessel lumens. Some ECs in RAMP2–/– mice were TUNEL positive. (M and N) Severe systemic edema observed in RAMP2–/–. Front (M) and side (N) views of WT and RAMP2–/– embryos at midgestation. Some RAMP2–/– embryos showed severe systemic edema. (O–R) Pericardial effusion in RAMP2–/– mice. (O and P) Magnified side view of embryos at midgestation revealing the appearance of the pericardial space in RAMP2–/– embryos. (Q and R) Sagittal sections showing the pericardial space in embryos at midgestation. The pericardial space was larger in RAMP2–/– than WT embryos and showed the accumulation of pericardial effusion. (S–U) Severe hemorrhagic changes in RAMP2–/– mice. (S) Side view of WT and RAMP2–/– embryos at midgestation. (T and U) Sections of the liver at the same stage. Some RAMP2–/– embryos showed severe hemorrhagic changes that were apparent on their surface and within the liver. Scale bars: 20 μm (E and F); 50 μm (I–L, T, and U); 200 μm (Q and R).

J. Clin. Invest. 118(1): 29-39 (2007)

Generation of RAMP2 KO mice. KO mice were generated as described previously (14, 16, 41, 42). Briefly, a plasmid-targeting vector was constructed to insert loxP sites encompassing exons 2–4 of RAMP2 and the neomycin resistance gene, after which the plasmid was linearized and introduced into Bruce 4 embryonic stem cells by electroporation. Homologous recombinants were identified, and 2 independently targeted clones were injected into BALB/c blastocysts to generate chimeric mice. Male chimeras were crossbred with C57BL/6 females, and germline transmission was verified by Southern blot analysis. After obtaining heterozygotic floxed RAMP2 mice, we crossbred them with CAG-Cre mice to delete exons 2–4 of the RAMP2 gene. The deletion of RAMP2 was certified by Southern blot analysis. The Cre gene was then removed from the line by backcrossing with C57BL/6 mice. All experiments were performed in accordance with the Declaration of Helsinki and were approved by the Shinshu University Ethics Committee for Animal Experiments.

J. Clin. Invest. 118(1): 29-39 (2007)

In situ hybridization. In situ hybridization was performed as described previously (43). cRNAs were prepared from linearized cDNA templates of murine RAMP2 (ACACTTTGCGAACTGCTCCCTGGTGCAGCCCACCTTCTCTGATCCCCCAGAGGATGTGCTCCTGGCCA TGATCATAGCCCCCATCTGCCTCATCCCGTTCCTTGTTACTCTTGTGGT GTGGAGGAGTAAAGACAGCGATGCCCAGGCCTAGGGTCCATTTCTCAGCAGCCATTTTTCCCCCCTTTTCCC TGCTGGAACCAGGAATGGCGCTCCTCCCCTCCCTACCCACTTACTC TCATCCTTCCCACAGACCTGTGGATTGGTGGAAATGGCAGC-AAAGGGGACTCACGACACAATG) to generate antisense and sense probes. The cRNA transcripts were synthesized according to the manufacturer’s instructions (Ambion).

J. Clin. Invest. 118(1): 29-39 (2007)

Histological examination. Whole embryos, yolk sac and placenta, were fixed in 4% phosphate-buffered paraformaldehyde (pH 7.2), embedded in paraffin, and cut into 4-μm sections for histological examination. Some yolk sacs were used for immunohistochemical staining with anti-mouse CD31 antibody (BD Biosciences — Pharmingen) to visualize blood vessels. Samples were stained with a Histofine MOUSESTAIN KIT (Nichirei Biosciences) and DAB chromogen and counterstained with methyl green. Apoptosis was visualized in green fluorescence using the TUNEL method with an Apoptosis In Situ Detection Kit (Chemicon) and nuclei were stained with Hoechst 33342. To evaluate the aortic wall structure, immunohistochemical staining was performed using anti-mouse type IV collagen antibody (Collaborative Research), phalloidin, and DAPI (Roche Diagnostics). Confocal microscopic observation was then carried out using a Leica TCS-SP2 laser scanning microscope.

J. Clin. Invest. 118(1): 29-39 (2007)

Transmission electron microscopy. Specimens were fixed in 2% glutaraldehyde (pH 7.2) and 4% osmium tetroxide, embedded in epoxy resin (Epok) 812 (Oken Shoji Co.), cut into ultrathin sections, double-stained with uranyl acetate and lead citrate, and examined by electron microscopy (JEM-1010; Jeol).

J. Clin. Invest. 118(1): 29-39 (2007)

Capillary formation on Matrigel. RAMP2O/E cells or control ECs were cultured on 24-well culture plates coated with Matrigel (BD) in medium containing 10–7 M recombinant hAM (Peptide Institute), and capillary formation was monitored microscopically. Photomicrographs were taken of 2 different fields in each well, and the degree of capillary formation was evaluated by quantification of the total capillary area in each field using NIH Image software. Capillary area was then presented relative to the cell surface area of the control cells on day 1.

J. Clin. Invest. 118(1): 29-39 (2007)

In vitro vascular permeability assay. To assay vascular permeability in vitro, we used a permeability chamber consisting of a 24-well tissue culture plate with cell culture inserts. The inserts contained a transparent polyethylene membrane with a high density of symmetrical pores (1 μm in diameter) that permitted high rates of basolateral diffusion. RAMP2O/E and control cells were seeded onto collagen-coated (Cellmatrix Type I-C; Nitta Gelatin Inc.) inserts, after which confluent endothelial monolayers that occluded the membrane pores were allowed to form over several days. The cell monolayers were then treated with 10 ng/ml VEGF, after which 13.3 mg/ml Dextran FITC Conjugate (MW 70,000; Research Organics) was added on top of the cells. The permeability of the monolayer was then assessed by measuring the fluorescence of the solution in the wells using a Multi-Detection Microplate Reader (POWERSCAN HT; DS Pharma Biomedical). The excitation and emission wavelengths were 485 nm and 530 nm, respectively.

J. Clin. Invest. 118(1): 29-39 (2007)

Structure of tight junction after cell injury. EAhy926 ECs were cultured until confluent on chamber slides in DMEM containing 10–7 M AM and then exposed to 0.5 mM H2O2. Two hours after the H2O2 treatment, the cells were immunostained with anti–ZO-1 antibody (BD Biosciences — Pharmingen) and the nucleus-specific dye Hoechst 33342 (Sigma-Aldrich) and observed under a confocal microscope.

J. Clin. Invest. 118(1): 29-39 (2007)

Aortic ring assay. After mice were killed with an overdose of anesthetic, the thoracic aorta was dissected from the posterior mediastinum, placed in serum-free EBM-2 endothelial basal medium (Cambrex), and cleaned of blood and fibroadipose tissue under a stereoscopic microscope using fine forceps and scissors. The vessel was then cut into 1-mm-long rings, which were subjected to 8 consecutive washes with serum-free EBM-2. The aortic rings were then embedded in thick collagen gel (Cellmatrix Type I-A; Nitta Gelatin Inc.) and cultured for 7 days, with or without recombinant hVEGF (50 ng/ml; R&D Systems) supplement. The capillaries that sprouted from the edges of the rings were analyzed (44).

J. Clin. Invest. 118(1): 29-39 (2007)

Matrigel assay. After mice were anesthetized, 500 μl Matrigel (BD) containing 100 ng recombinant hbFGF (Wako) was injected subcutaneously into the dorsal region using a 25-gauge needle and permitted to solidify. Seven days later, the mice were killed with an overdose of anesthetic, the skin around the injected sites was incised, and the angiogenic response to the implanted Matrigel was analyzed.

J. Clin. Invest. 118(1): 29-39 (2007)

Skin edema model. Vascular permeability leading to mouse skin edema was assayed as described previously (47). Mice were injected via the tail vein with 0.2 ml of 1.5% FITC-BSA (15 mg/ml) in isotonic Tyrode solution, which served as a tracer of vascular permeability. Thereafter, serum exudation was induced by subcutaneous injection of histamine (1 μg/100 μl/site) into the shaved dorsal skin. Thirty minutes later, the injected sites in the dorsal skin were removed as circular patches and put into the wells of a 24-well culture plate. Formamide (1 ml) was then added to each well and incubated at 50°C for 2 h, after which the fluorescence intensity in each well was measured using a Multi-Detection Microplate Reader; the excitation and emission wavelengths were 485 nm and 530 nm, respectively.

J. Clin. Invest. 118(1): 29-39 (2007)

Brain edema model (cold lesion model). Mice were mounted in a stereotaxic frame (Narishige), after which the scalp was incised, subcutaneous tissue was retracted from the bone, and the skull was exposed. Using a drill, a circular craniotomy was then carried out over the right parietal cortex, extending from the lambda suture to bregma, and the resultant bone flap was lifted off to expose the underlying dura. The cold lesion was made using a copper cylinder (3 mm in diameter) that had been precooled with liquid nitrogen. The metal probe was lowered quickly onto the surface of the intact dura over the parietotemporal cortex under microscopic control and pressed down to a depth of 1 mm for 30 seconds (48). To quantify the vascular permeability of brain vessels, 0.2 ml of sodium fluorescein at a concentration of 6 mg/ml in PBS was injected via the tail vein 24 hours after making the cold lesions. Thirty minutes later, the mice were anesthetized and perfused with PBS (20 ml) via the left cardiac ventricle to remove the fluorescent tracer from the vascular bed. To assess their fluorescence, brain hemispheres were homogenized in 0.5 M borate buffer (pH 10) and centrifuged (800 g) for 15 min at 4°C, after which the supernatant was added to 1.2 ml of ethanol to precipitate the proteins. The samples were again centrifuged, and the fluorescence in the supernatant was measured using a Multi-Detection Microplate Reader (49); the excitation and emission wavelengths were 330 nm and 485 nm, respectively.